Journal:

Article Title: Characterization of an Endoprotease (PrpL) Encoded by a PvdS-Regulated Gene in Pseudomonas aeruginosa

doi: 10.1128/IAI.69.9.5385-5394.2001

Figure Lengend Snippet: Strains, plasmids, and primers used in this study

Article Snippet: Laboratory collection S21, S22, S28, S38, S40, S41, S44, S47, S52 CF isolates from British Columbia's Children's Hospital and Shaughnessy Hospital, Vancouver, British Columbia, Canada 22 B15, B16, B22, B31, B34, B35, B38, B43, B44, B47, B48, B51 Blood isolates from Nagasaki University Hospital, Nagasaki, Japan 22 ccu1-6, ccu-7, ccu-8 Environmental strains from Horry and Georgetown Counties in South Carolina 16 P. putida PPG1 Prototroph Laboratory collection E. coli DH5α hsdR recA lacZYA φ80 lacZ ΔM15 Gibco BRL HB101 hsdS recA proA lacY 4 SM10 Km r , mobilizer strain 47 Plasmids pBluescript SK(+) Amp r lacZ, E. coli cloning vector Stratagene pCRII-2.1 Amp r Km r , TA cloning vector for PCR products Invitrogen pEX100T Amp r oriT mob sacB 46 pEX100 DprpL :: Gm pEX100T containing Δ prpL :: Gm This study pRK2013 Km r , conjugation helper plasmid 17 pVLT31 Broad-host-range expression vector, Tet r 9 pPVD31 pVLT31 containing pvdS under tac promoter control, Tet r 33 Primers b PJW3 TGGAAACCCACAGCGGCTCGCTG; internal to prpL Gibco BRL PJW4 GTACTTCTTGGCGTCGCCGCGCC; internal to prpL Gibco BRL PJW17 ATTTCGCTCGCACCGGGC; flanking prpL promoter Gibco BRL PJW19 CCACGTCAGCGGCAAGCT; flanking prpL promoter Gibco BRL Open in a separate window a Abbreviations: Amp r , ampicillin resistance; Km r , kanamycin resistance; Tet r , tetracycline resistance; mob , mobilization site; oriT , origin of transfer (RK2). b All primers were synthesized by Gibco Bethesda Research Laboratories (BRL).

Techniques: Plasmid Preparation, Clone Assay, TA Cloning, Conjugation Assay, Expressing

Journal:

Article Title: Characterization of Saa, a Novel Autoagglutinating Adhesin Produced by Locus of Enterocyte Effacement-Negative Shiga-Toxigenic Escherichia coli Strains That Are Virulent for Humans

doi: 10.1128/IAI.69.11.6999-7009.2001

Figure Lengend Snippet: Adherence of E. coli JM109 expressing cloned saa genes to HEp-2 cells (Giemsa stain). (A) E. coli JM109:pBluescript; (B) JM109:pJCP563; (C) JM109:pJCP564; (D) JM109:pJCP565.

Article Snippet: The phagemids pBluescript SK (encoding ampicillin resistance) and pBC SK (encoding chloramphenicol resistance) were obtained from Stratagene, La Jolla, Calif. All cells of E. coli strains were routinely grown in Luria-Bertani (LB) medium ( 19 ) with or without 1.5% Bacto-Agar (Difco Laboratories, Detroit, Mich.).

Techniques: Expressing, Clone Assay, Giemsa Stain

Journal:

Article Title: Contributions of MexAB-OprM and an EmrE Homolog to Intrinsic Resistance of Pseudomonas aeruginosa to Aminoglycosides and Dyes

doi: 10.1128/AAC.47.1.27-33.2003

Figure Lengend Snippet: P. aeruginosa strains and plasmids used in this study

Article Snippet: In the ethidium bromide accumulation experiments, M63 minimal medium [13.6 g of KH 2 PO 4 , 2 g of (NH 4 ) 2 SO 4 , and 0.5 mg of FeSO 4 per liter; pH 7.0] supplemented with glucose (0.2%) and MgSO 4 (10 mM) was used. table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 P. aeruginosa strain or plasmid Description Source or reference P. aeruginosa PAO1 Prototroph 10 HN1112 Spontaneous streptomycin-resistant ( rpsL ) derivative of PAO1 This study HN1113 HN1112 Δ emrE This study K1119 PAO1 Δ mexAB-oprM 9 HN1114 Spontaneous streptomycin-resistant ( rpsL ) derivative of K1119 This study HN1115 HN1113 Δ mexAB-oprM This study K1589 Spontaneous streptomycin-resistant ( rpsL ) derivative of PAO1 made Δ mexR Δ mexB K. Poole HN1116 K1589 Δ emrE This study Plasmids pEX18Tc Broad-host-range gene replacement vector; sacB, tetracycline resistant 4 pXZL1307 pEX18Tc::Δ emrE This study pELCT04 pK18mob sacB ::ΩHg r and Δ mexAB-oprM, kanamycin and HgCl 2 resistant 9 pBluescript II SK(+) Cloning vector, ampicillin resistant Stratagene pXZL1582 pBluescript II SK(+):: emrE Pae This study Open in a separate window P. aeruginosa strains and plasmids used in this study Plasmids were maintained in E. coli with appropriate selection [pEX18Tc, 10 μg of tetracycline per ml; pECLT04, 50 μg of kanamycin per ml or 15 μg of HgCl 2 per ml; and pBluescript II SK(+), 100 μg of ampicillin per ml].

Techniques: Plasmid Preparation, Clone Assay